View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_low_17 (Length: 267)
Name: NF0428_1D_low_17
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_1D_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 31171114 - 31170887
Alignment:
| Q |
14 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggccaaagtcataaaagtttatttcttcctttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31171114 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggccaaagtcataaaagtttatttcttcctttt |
31171015 |
T |
|
| Q |
114 |
ccctccttaagatctctgttcgtaagataatttcataatgtcgtannnnnnncctttctgctcaatggctactaatttatgacaaacaattttgagcaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31171014 |
ccctccttaagatctctgttcgtaagataatttcataatgtcgtattttttccctttctgctcgatggctactaatttatgacaaacaattttgagcaaa |
31170915 |
T |
|
| Q |
214 |
tatcacttgctttttaacttttcatact |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31170914 |
tatcacttgctttttaacttttcatact |
31170887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 35224494 - 35224424
Alignment:
| Q |
14 |
tggacatcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggcc |
84 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35224494 |
tggacatctgctgcacagctatcattactcgaagatgaaatgcgccgtatagaaagagtcaatgtaaggcc |
35224424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 175 times since January 2019
Visitors: 3259