View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0428_1D_low_19 (Length: 256)

Name: NF0428_1D_low_19
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0428_1D_low_19
NF0428_1D_low_19
[»] chr1 (5 HSPs)
chr1 (4-239)||(9804675-9804910)
chr1 (124-256)||(9817561-9817693)
chr1 (121-253)||(9817445-9817577)
chr1 (131-239)||(9817341-9817448)
chr1 (1-63)||(9817777-9817839)
[»] scaffold0432 (3 HSPs)
scaffold0432 (117-253)||(11572-11708)
scaffold0432 (5-60)||(11788-11843)
scaffold0432 (121-239)||(11467-11585)
[»] chr7 (1 HSPs)
chr7 (1-63)||(42778839-42778900)


Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 4 - 239
Target Start/End: Complemental strand, 9804910 - 9804675
Alignment:
4 ttgcccaaataatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactggtcgatgtcgatc 103  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
9804910 ttgcccaaataatgaaacgaggttgaactttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactgatcgatgtcgatc 9804811  T
104 tcagtgaagtttcatggttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgttt 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||    
9804810 tcagtgaagtttcatggttcttttttctgatcgatgtcgatctcagtgatggtgcttggagagaggttggcaacagcgattgagggagaaaattgtgttt 9804711  T
204 agggtttcaagagaatgagaaatgaggatgggagga 239  Q
    ||||||||||||||||||||||||||||||||||||    
9804710 agggtttcaagagaatgagaaatgaggatgggagga 9804675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 124 - 256
Target Start/End: Complemental strand, 9817693 - 9817561
Alignment:
124 ttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgaga 223  Q
    ||||||||||||||||||||||||||  ||| || |||||||||||||| ||||||||  |||||| ||||||| ||||||||||||||||| |||||||    
9817693 ttttttctgatcgatgtcgatctcagcaatgttggtaggagagaggttgtcaacggcggatgagggggaaaattgtgtttagggtttcaagataatgaga 9817594  T
224 aatgaggatgggaggattattttgtttgattga 256  Q
    |||||||||||||||||| ||||||||||||||    
9817593 aatgaggatgggaggattcttttgtttgattga 9817561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 121 - 253
Target Start/End: Complemental strand, 9817577 - 9817445
Alignment:
121 ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg 220  Q
    ||||||| | |||| |||||||||||||   |||||| ||||||||||||||||| | |||  |||||||||||| ||||||||||||||||| ||||||    
9817577 ttcttttgtttgattgatgtcgatctcacctatggtggtaggagagaggttggcagcagcggctgagggagaaaactttgtttagggtttcaaaagaatg 9817478  T
221 agaaatgaggatgggaggattattttgtttgat 253  Q
    |||||||||||| |||||||| ||||| |||||    
9817477 agaaatgaggattggaggattcttttgattgat 9817445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 131 - 239
Target Start/End: Complemental strand, 9817448 - 9817341
Alignment:
131 tgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagg 230  Q
    ||||||||||||||| ||| ||||||| || |||||||||||||| |||||  |||||||||||| | ||||||||||||| ||||||||||||||||||    
9817448 tgatcgatgtcgatc-cagcgatggtggtatgagagaggttggcagcggcggctgagggagaaaactgtgtttagggtttctagagaatgagaaatgagg 9817350  T
231 atgggagga 239  Q
    |||||||||    
9817349 atgggagga 9817341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 9817839 - 9817777
Alignment:
1 tttttgcccaaataatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataacca 63  Q
    ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||    
9817839 tttttgcccaaataatggaacgaggttgaagtttcatgaaaattccatcaaaagagataacca 9817777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0432 (Bit Score: 57; Significance: 7e-24; HSPs: 3)
Name: scaffold0432
Description:

Target: scaffold0432; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 117 - 253
Target Start/End: Complemental strand, 11708 - 11572
Alignment:
117 atggttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagag 216  Q
    ||||||||||||||  |||||||| |||||||| ||||||| || |||||||||||| | |||   ||||| || |||| ||||||| | | ||||||||    
11708 atggttcttttttccaatcgatgttgatctcagcgatggtggtatgagagaggttggtagcgggagttgagagataaaactttgttttgagattcaagag 11609  T
217 aatgagaaatgaggatgggaggattattttgtttgat 253  Q
    |||| ||| |||||||||||||||| |||||||||||    
11608 aatgggaagtgaggatgggaggattcttttgtttgat 11572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0432; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 11843 - 11788
Alignment:
5 tgcccaaataatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataa 60  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
11843 tgcccaattaatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataa 11788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0432; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 121 - 239
Target Start/End: Complemental strand, 11585 - 11467
Alignment:
121 ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg 220  Q
    ||||||| | ||||| ||||||||||||| | | ||| ||| ||||||||||||| || ||   ||||||||||| | ||| | || ||||| ||||||     
11585 ttcttttgtttgatcaatgtcgatctcagcggtagtggtagaagagaggttggcagcgacggccgagggagaaaactgtgtgtgggatttcatgagaata 11486  T
221 agaaatgaggatgggagga 239  Q
    |||||||||||||||||||    
11485 agaaatgaggatgggagga 11467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 42778839 - 42778900
Alignment:
1 tttttgcccaaataatgaaacgaggttgaagtttcatgaaaactccatcaaaagagataacca 63  Q
    ||||||| ||| | |||||||||||||||| || |||||||||||| ||||||||||||||||    
42778839 tttttgctcaattgatgaaacgaggttgaa-ttgcatgaaaactccgtcaaaagagataacca 42778900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 218 times since January 2019
Visitors: 3261