View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_low_22 (Length: 245)
Name: NF0428_1D_low_22
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_1D_low_22 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 245
Target Start/End: Complemental strand, 179689 - 179455
Alignment:
| Q |
11 |
tcatccggaggcaactggtgtattaggacgttgatatctgacattgcacctagtttagccaaatagtcagcactttgatttccttcccggagggtgtggt |
110 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
179689 |
tcatccggaggcgactggtgtattagaacgttgacatctgacattgcacctagtttagccaaatagtcagcactttgatttccttcccggagggtgtggt |
179590 |
T |
 |
| Q |
111 |
tgagcgaaaaattctttagagaaagcttgtctctgatgtcttggataagggctacatgaatatggaactttgagctggtggtattgatgagattaattga |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
179589 |
tgagcgaaaaattccttagagaaagcttgtctctgatatcttggattagggccgcatgaatatggaactttgaactggtggtagtgatgagattaattga |
179490 |
T |
 |
| Q |
211 |
aaggagagaatctaaataaaccgccatgtctgtga |
245 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
179489 |
aaggagagaatctgaataaaccgccatatctgtga |
179455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 231
Target Start/End: Original strand, 45440000 - 45440036
Alignment:
| Q |
195 |
tgatgagattaattgaaaggagagaatctaaataaac |
231 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
45440000 |
tgatgaggttaattgaaaggagggaatctaaataaac |
45440036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University