View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_low_26 (Length: 241)
Name: NF0428_1D_low_26
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_1D_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 25 - 218
Target Start/End: Complemental strand, 11643950 - 11643757
Alignment:
| Q |
25 |
ggagtttggagttggttatttctgttataactgtaaccaacaaagcttgtaccttcagctctatataagagcattctttccttttgaaataacaagttaa |
124 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11643950 |
ggagttgggagttggttatttctgttataactgtaaccaacaaagcttgtaccttcagctctatataatagcattctttccttttgaaataacaagttag |
11643851 |
T |
|
| Q |
125 |
ttcattatgctatttttctttaccttacattcctaaaaccaacaacaccctagggttttaaatagtagtcgtggtaacacttgcggtcatatct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11643850 |
ttcattatgctatttttctttaccttacactcctaaaaccaacaacaccctagggttttaaatagtagtcgtggtaacacttgcggtcatatct |
11643757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 37 - 153
Target Start/End: Original strand, 24624930 - 24625047
Alignment:
| Q |
37 |
tggttatttctgttataactgtaaccaacaaagcttgtaccttcagctctatataagagcattctttccttttgaaat-aacaagttaattcattatgct |
135 |
Q |
| |
|
||||||| ||||||||| |||||| ||| ||| ||||| ||||||||||||||||||||| ||| |||||||||| ||||||||| |||||| |||| |
|
|
| T |
24624930 |
tggttatatctgttataggagtaacctacatagcctgtactttcagctctatataagagcatctttttcttttgaaataaacaagttatttcattctgct |
24625029 |
T |
|
| Q |
136 |
atttttctttaccttaca |
153 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
24625030 |
atttttctctaccttaca |
24625047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1885 times since January 2019
Visitors: 3241