View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_low_30 (Length: 234)
Name: NF0428_1D_low_30
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_1D_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 4768225 - 4768455
Alignment:
| Q |
1 |
tgtgcatcaatattgtccacacaatctgcaggtaaacacaagacagtcgttaggcaggaagatctgaacacaatttcctttatagcactcatgatccgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4768225 |
tgtgcatcaatattgtccacacaatctgcagttaaacacaagacagtcgttaggcaggaagatctgaacacaatttcctttatagcactcatgatccacc |
4768324 |
T |
|
| Q |
101 |
ataacctaaatgttcagtaatttacactaccttgaagcccgagttcaactaatttgagatagccaccgggttgtagcaactctccaacaattctgtcagg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4768325 |
ataacctaaaggttcagtaatttacactaccttgaagcccgagttcaactaatttgagatagccaccgggttgtagcaactctccaacaattctgtcagg |
4768424 |
T |
|
| Q |
201 |
ctcactcaaatctctttcaataatatgcact |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4768425 |
ctcactcaaatctctttcaataatatgcact |
4768455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 125 - 225
Target Start/End: Complemental strand, 47790390 - 47790290
Alignment:
| Q |
125 |
cactaccttgaagcccgagttcaactaatttgagatagccaccgggttgtagcaactctccaacaattctgtcaggctcactcaaatctctttcaataat |
224 |
Q |
| |
|
||||||| | ||| || ||||||| ||||||||||| || || ||||||||||||||||||||||||| ||| || ||| ||| ||||||||||||||| |
|
|
| T |
47790390 |
cactaccatcaagtcccagttcaatcaatttgagataacctccaggttgtagcaactctccaacaattcggtctggttcattcagatctctttcaataat |
47790291 |
T |
|
| Q |
225 |
a |
225 |
Q |
| |
|
| |
|
|
| T |
47790290 |
a |
47790290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 231
Target Start/End: Original strand, 12252993 - 12253055
Alignment:
| Q |
169 |
ggttgtagcaactctccaacaattctgtcaggctcactcaaatctctttcaataatatgcact |
231 |
Q |
| |
|
||||||||||| ||||| ||||| || ||||||||| ||| |||||||||||| | ||||||| |
|
|
| T |
12252993 |
ggttgtagcaattctcctacaatcctatcaggctcattcagatctctttcaatgacatgcact |
12253055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 36747814 - 36747878
Alignment:
| Q |
157 |
agatagccaccgggttgtagcaactctccaacaattctgtcaggctcactcaaatctctttcaat |
221 |
Q |
| |
|
||||||||||| ||||| ||||| || || |||||||| ||||||||| | || ||||||||||| |
|
|
| T |
36747814 |
agatagccaccaggttgaagcaattcacccacaattctatcaggctcagttaagtctctttcaat |
36747878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 101 times since January 2019
Visitors: 3270