View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_low_33 (Length: 229)
Name: NF0428_1D_low_33
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_1D_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 228
Target Start/End: Complemental strand, 3685237 - 3685022
Alignment:
| Q |
13 |
gatggacatcagagcgtagagtattcagacggttgtttgcgtttgttgaaccatatgaagtaatatgctcggacccctgtcttacatccatctcagatgc |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3685237 |
gatgcacatcagagcgtagagtattcagacggttgtttgcgtttgttgaaccatatgaagtaatatgctcggatccctgtcttacatccatctcagatgc |
3685138 |
T |
|
| Q |
113 |
tgaatcaagaaaagcgagcatcttaagggcgctataatagtacatcatccccctgactgtgcgagacaatgtttgacctctataagatacccaaaggcga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3685137 |
tgaatcaagaaaagcgagcatcttaagggcgctataatagtacatcatccccctgactgtgcgagacaatgtttgacctctgtaagatacccaaaggcga |
3685038 |
T |
|
| Q |
213 |
aggtccaaggattttg |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3685037 |
aggtccaaggattttg |
3685022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1910 times since January 2019
Visitors: 3241