View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_low_34 (Length: 226)
Name: NF0428_1D_low_34
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_1D_low_34 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 934563 - 934353
Alignment:
| Q |
16 |
acatcatcctcatgcaattcttccttggctacctgatattgtgtaagatcttcatccttgttctgcatataagagcaggccaaaattataaaaattcata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
934563 |
acatcatcctcatgcaattcttccttggctacctgatattgtgtaagatcttcatccttgttctgcatataagagcaggccaaaattataaaaattcata |
934464 |
T |
 |
| Q |
116 |
atgtatgcatgtaaattagatacaaagatatagttcaaaattttccttttcaaaatacaaccaaggtatccgggacctggatgcttgtgataattaaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
934463 |
atgtatgcatgtaaattagatacaaagatatagttcaaaattttccctttcaaaatacaaccaaggtatccgggacctggatgcttgtgataattaaatt |
934364 |
T |
 |
| Q |
216 |
tactgttatta |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
934363 |
tactgttatta |
934353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University