View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_1D_low_39 (Length: 208)
Name: NF0428_1D_low_39
Description: NF0428_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0428_1D_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 7 - 197
Target Start/End: Original strand, 47705315 - 47705505
Alignment:
Q |
7 |
agtttaaagtacttaagnnnnnnnggaagatattcatacactagtacttctttatcttttcctttccattgatctagtaatgtctttctaatcataccat |
106 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47705315 |
agtttaaagtacttaagtttttttggaagatattcatacactagtacttctttatcttttcctttccattgatctagtaatgtctttctaatcataccat |
47705414 |
T |
 |
Q |
107 |
gttcccctccagcaaagaaagcaagtatagaacgattatttgggtctttgcctggaattggtgagctcaacttgtaaccttgtaggttcat |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47705415 |
gttcccctccagcaaagaaagcaagtatagaacgattatttgattctttgcttggaattggtgagctcaacttgtaaccttgtaggttcat |
47705505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University