View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_2D_high_8 (Length: 256)
Name: NF0428_2D_high_8
Description: NF0428_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_2D_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 14417574 - 14417479
Alignment:
| Q |
1 |
ccttttaatatatgcctccatgcctttttagctgagtttattatttttgttctctcgataaaaaatgttacatgcacttcattcgttttctctcgc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14417574 |
ccttttaatatatgcctccatgcctttttagccgagtttattatttttgctctctcgataaaaaatgttacatgcacttcattcgttttctctcgc |
14417479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 175 - 225
Target Start/End: Complemental strand, 14417400 - 14417350
Alignment:
| Q |
175 |
gccctgtgtctagtgtatgagtggatgcaataataaactttatgatttgag |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14417400 |
gccctgtgtctagtgtatgagtggatgcaataataaactttgtgatttgag |
14417350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 17 - 96
Target Start/End: Complemental strand, 25035864 - 25035785
Alignment:
| Q |
17 |
tccatgcctttttagctgagtttattatttttgttctctcgataaaaaatgttacatgcacttcattcgttttctctcgc |
96 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
25035864 |
tccatgcctttttagcacaatttattatttttgttctctccgtaaaaaatgttacacgcacttcattcgttttatctcgc |
25035785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 181 - 227
Target Start/End: Complemental strand, 25035702 - 25035656
Alignment:
| Q |
181 |
tgtctagtgtatgagtggatgcaataataaactttatgatttgagga |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | ||||||||||| |
|
|
| T |
25035702 |
tgtctagtgtatgagtggatgcaataataagctctgtgatttgagga |
25035656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 227
Target Start/End: Original strand, 44512595 - 44512647
Alignment:
| Q |
175 |
gccctgtgtctagtgtatgagtggatgcaataataaactttatgatttgagga |
227 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| | ||||||||||||| |
|
|
| T |
44512595 |
gccctgtgtcaagtgtatgagtgggtgcaataataagttctatgatttgagga |
44512647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University