View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_2D_low_14 (Length: 262)
Name: NF0428_2D_low_14
Description: NF0428_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_2D_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 52622670 - 52622435
Alignment:
| Q |
1 |
attagtaacaaggattaaattgttggaataatgaatctgatctagctatatagataggattttgtaatcgatttgattcaattaatccatatcctatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52622670 |
attagtaacaaggattaaattgttggaataatgaatctgatctagctatatagataggattttgtaatcgatttgattcaattaatccatatcctatata |
52622571 |
T |
|
| Q |
101 |
tctatgaaccacttcnnnnnnnnnnnnnntctgaacaaaaactaggttcttgatatctttcttaatttattattattaatatggtatgtggggttctaag |
200 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
52622570 |
tctatgaaccacttc------atatatattctgaataaaaactaggttcttgatatctttcttaat---ttattattaatatggtgtgtggggttctaag |
52622480 |
T |
|
| Q |
201 |
gaagtcctacccaaatttctcaatacatttcttgttgacgtgttt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52622479 |
gaagtcctacccaaatttctcaatacatttcttcttgacgtgttt |
52622435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 151 times since January 2019
Visitors: 3259