View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_2D_low_15 (Length: 262)
Name: NF0428_2D_low_15
Description: NF0428_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_2D_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 27 - 262
Target Start/End: Original strand, 20581688 - 20581923
Alignment:
| Q |
27 |
tttaatttatgactatgtttatgtggtagaacgtattatatactcatcaaagttgtgtctatatcacttcggaacagagctgcattttttaaatagtgaa |
126 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
20581688 |
tttaatttatgactatgtttatgtggtcgaacgtattatatactgatcaaagttgtgtctatatcacttcgaaacagagctgcatttttttcatagtgaa |
20581787 |
T |
 |
| Q |
127 |
caaattgtttcattcattcatttgtagaaacagtagaaaaggcttattcagttttcatagaggcattattaatctagctttggtttcaaagccataagtt |
226 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
20581788 |
caaattgtttcattcattcatttggagaaacagtacaaaaggcttattcagttttcatagaggcattatcaatctagctttggtttcaaagccataagct |
20581887 |
T |
 |
| Q |
227 |
aaacctacaagatataaagttctactgatatatcta |
262 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
20581888 |
aaacctacaagatacaaagttctattgatatatcta |
20581923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University