View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_2D_low_23 (Length: 221)
Name: NF0428_2D_low_23
Description: NF0428_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0428_2D_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 40514611 - 40514423
Alignment:
Q |
17 |
ttaaatgataaatacttaagggtacatgagttgctaccagttttaatgttgctaataaaagctttctcttaaaaaaggaactagcttatgagtatgctaa |
116 |
Q |
|
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
40514611 |
ttaaatgataaatattttagggtacatgagttgctaccagttttaatgttgctaataaaagctttctct-aaaaaaggaactagcttatgagtatgctaa |
40514513 |
T |
 |
Q |
117 |
gagaggagcaaggttgtctctaattgacattcgaaaagagaatcttgtaacagtggctgatatggcaaggtctcttggttcccctgatgt |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40514512 |
gagaggagcaaggttgtctctaattgacattcgaaaagagaatcttgtaacagtggctgatatggcaaggtctcttggttcccctgatgt |
40514423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1779 times since January 2019
Visitors: 3237