View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_high_5 (Length: 228)
Name: NF0428_high_5
Description: NF0428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0428_high_5 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 228
Target Start/End: Complemental strand, 29464578 - 29464365
Alignment:
Q |
15 |
cctgaaaagttatgtatcaactagcaaattgcatatggataattgtattattgattaaactttgttactccttttttatcttgtgattaatgatgatgct |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29464578 |
cctgaaaagttatgtatcaactagcaaattgcatatggataattgtattattgattaaactttgttactccttttttatcttgtgattaatgatgatgct |
29464479 |
T |
 |
Q |
115 |
aatatgattttaatttcatctaacactggatgataagcatgatagattatgcaacactcaaccatttatgatatgtgatgattaggtgaaaaggtcaaat |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29464478 |
aatatgattttaatttcatctaacactggatgataagcatgatagattatgcaacactcaaccatttatgatatgtgatgattaggtgaaaaggtcaaat |
29464379 |
T |
 |
Q |
215 |
tccattatagtgca |
228 |
Q |
|
|
|||||||||||||| |
|
|
T |
29464378 |
tccattatagtgca |
29464365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1609 times since January 2019
Visitors: 3232