View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0428_low_5 (Length: 249)
Name: NF0428_low_5
Description: NF0428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0428_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 29464232 - 29463996
Alignment:
| Q |
1 |
cgtagtttgggtaacatgactagagtctctgattttttcgaacgatttgctatttgatgaacctcattaacattggaattcaatcacttgtttagtcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| ||||| |||||||||||| ||||||||||||| ||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
29464232 |
cgtagtttgggtaacatgactaaagtttctcgtttttccgaacgatttgccatttgatgaaccttattaacacttgaattcaatcacttgtttaatcaaa |
29464133 |
T |
 |
| Q |
101 |
ctttacttgccttaaaatctaaactaagatccatttctttttaaaagctaagaattgagataaaagaactcttatgaaggtaatgaaatgtatatgttta |
200 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464132 |
ctttacttgccttcaaatctaaactaaggtccatttctttttaaaaactaagaattgagataaaagaactcttatgaaggtaatgaaatgtatatgttta |
29464033 |
T |
 |
| Q |
201 |
tcaaactcttttgcaataaatttttggatatatattc |
237 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29464032 |
tcaaactcttttgcaataattttttggatatatattc |
29463996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University