View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0429_high_9 (Length: 294)
Name: NF0429_high_9
Description: NF0429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0429_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 40942470 - 40942190
Alignment:
Q |
1 |
gtgtcaaggttgcaagactattttaaagggaggtgatgggtgatgaatttcctaaacgataaaagtatagctacaatgtgaaaaaggtagaagtatgaat |
100 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40942470 |
gtgtcaagattgcaagactattttaaagggaggtgatgggtgatgaatttcctaaacgataaaagtatagctacaatgtgaaaaaggtagaagtatgaat |
40942371 |
T |
 |
Q |
101 |
aaaaatgttatattgaatatgaacatgacagatgcccataagttttggaatgttcatgcaacatagaccaaaatagcacatcaagattttattgattgaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40942370 |
aaaaatgttatattgaatatgaacatgacagatgcccataagttttggaatgttcatgcaacatagaccaaaatagcacatcaagattttattgattgaa |
40942271 |
T |
 |
Q |
201 |
acaagttttaaaattggaatgaaaaagaacatgtccttccacaagcaatgatctaaattaccttcagcacagctgcaacag |
281 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40942270 |
acaagttttaaaattggaaggaaaaagaacatgtccttccacaagcaatgatctaaattaccttcagcacagctgcaacag |
40942190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University