View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0429_low_11 (Length: 319)
Name: NF0429_low_11
Description: NF0429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0429_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 197 - 260
Target Start/End: Complemental strand, 49044944 - 49044879
Alignment:
| Q |
197 |
tttattctttcctttttctccaaggcaggatcct--atttcctcattggctgcactgtttcagtgt |
260 |
Q |
| |
|
||||||| |||||||||||||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
49044944 |
tttattccttcctttttctccaagacaggttcctgaatttcctcattggctgcactgtttcagtgt |
49044879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 196 - 260
Target Start/End: Complemental strand, 49049312 - 49049246
Alignment:
| Q |
196 |
atttattctttcctttttctccaaggcaggatccta--tttcctcattggctgcactgtttcagtgt |
260 |
Q |
| |
|
|||||||| ||||||||||| |||| |||| ||||| |||||||||||||||||| | |||||||| |
|
|
| T |
49049312 |
atttattccttcctttttctgcaagacaggttcctaaatttcctcattggctgcaccgcttcagtgt |
49049246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1616 times since January 2019
Visitors: 3233