View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0429_low_12 (Length: 313)
Name: NF0429_low_12
Description: NF0429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0429_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 97 - 208
Target Start/End: Complemental strand, 41765553 - 41765442
Alignment:
| Q |
97 |
gaagaaagccaaaattgatctcttagatggtgatggtccaccaagaagatcatcaattatgccggttcgaacattgatttctggaatagatacatctttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41765553 |
gaagaaagccaaaattgatctcttagatggtgatggtccgccaagaagatcatcaattatgccggttcgaacattgatttctggaatagatacatctttt |
41765454 |
T |
 |
| Q |
197 |
actggcttgaat |
208 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41765453 |
actggcttgaat |
41765442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 97 - 208
Target Start/End: Complemental strand, 41757470 - 41757359
Alignment:
| Q |
97 |
gaagaaagccaaaattgatctcttagatggtgatggtccaccaagaagatcatcaattatgccggttcgaacattgatttctggaatagatacatctttt |
196 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| || |||| || | ||| ||| | |||||| ||| |||| ||||||||||||||||||| ||| |
|
|
| T |
41757470 |
gaagaaagccaaaactgatcgcttagatggtgatggcccgccaacaataccatgtattgtaccggtttgaagattggtttctggaatagatacatccttt |
41757371 |
T |
 |
| Q |
197 |
actggcttgaat |
208 |
Q |
| |
|
| ||||||||| |
|
|
| T |
41757370 |
gcaggcttgaat |
41757359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University