View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0433_high_2 (Length: 251)
Name: NF0433_high_2
Description: NF0433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0433_high_2 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 85 - 251
Target Start/End: Complemental strand, 4057709 - 4057543
Alignment:
| Q |
85 |
cattacaaagtaaacttgagtataaagaatacatactaannnnnnnacacagtcattcgatcatattacattataatatttccctaaaataaaagattac |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4057709 |
cattacaaagtaaacttgagtataaagaatacatactaatttttttacacagtcattcgatcatattacattataatatttccctaaaataaaagattac |
4057610 |
T |
|
| Q |
185 |
atcataatatctcactaatcactttattgtatgccatttttaaatatttcaattaatatcgtgatga |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4057609 |
atcataatatctcactaatcactttattgtatgccatttttaaatatttcaattaatatcgtgatga |
4057543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 65 times since January 2019
Visitors: 3244