View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0433_low_10 (Length: 232)
Name: NF0433_low_10
Description: NF0433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0433_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 7368191 - 7368327
Alignment:
Q |
1 |
caattttaatgcgatccttccaagtttcaaacatattccttatcatataagttcgatatctcattgatgatgtgtattttttaatagagaaagtgtaact |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7368191 |
caattttaatgcgatccttccaagtttcaaacatattccttgtcatataagttcgatatctcattgatgatgtgtattttttaatagagaaagtgtaact |
7368290 |
T |
 |
Q |
101 |
cttactaagtaatgaagctaagtttcataccaaaatg |
137 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
7368291 |
cttactaagtaatgaagctaagtttcataccaaaatg |
7368327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1780 times since January 2019
Visitors: 3237