View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0434_low_20 (Length: 227)
Name: NF0434_low_20
Description: NF0434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0434_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 7 - 78
Target Start/End: Complemental strand, 1971486 - 1971415
Alignment:
Q |
7 |
agagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatacggggggt |
78 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
1971486 |
agagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatacggagggt |
1971415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 7 - 76
Target Start/End: Complemental strand, 19962498 - 19962429
Alignment:
Q |
7 |
agagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatacggggg |
76 |
Q |
|
|
|||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
T |
19962498 |
agagacggttgcagtagagacaaaacgaccaaagttggtgccgccatggatgatggtggtgatacggggg |
19962429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University