View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0434_low_8 (Length: 359)

Name: NF0434_low_8
Description: NF0434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0434_low_8
NF0434_low_8
[»] chr7 (2 HSPs)
chr7 (134-280)||(17355838-17355984)
chr7 (25-75)||(17355768-17355818)


Alignment Details
Target: chr7 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 134 - 280
Target Start/End: Original strand, 17355838 - 17355984
Alignment:
134 tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttgtgggtcatatc 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||    
17355838 tcatatttgttttttgggcttatgtttcttgattttcttttaagaaagaacaagatcttgtattggtatggctaccattacaaatcttatgggtcttatc 17355937  T
234 tttcatttcttgatcaattgtcgtgaatcgttgattagatcgaacta 280  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
17355938 tttcatttcttgatcaattgtcgtgaatcgttgattagatcgaacta 17355984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 25 - 75
Target Start/End: Original strand, 17355768 - 17355818
Alignment:
25 gatggacatcatcatcatgaaccccttcttcttcatattttcatcatctta 75  Q
    |||||||||| |||||||||||| |||||||||||||||||||||||||||    
17355768 gatggacatcttcatcatgaacctcttcttcttcatattttcatcatctta 17355818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1443 times since January 2019
Visitors: 3230