View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_10 (Length: 351)
Name: NF0435_low_10
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0435_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 77 - 322
Target Start/End: Original strand, 43875142 - 43875387
Alignment:
| Q |
77 |
gaggagcagagatggtaagtggtggatgcggtggtgtgaagggaagaagaggaagccgagacggcagcgaagaagtgtcgccggcagcgttaatgttagc |
176 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875142 |
gaggaccagtgatggtaagtggtggatgcggtggtgtgaagggaagaagaggaagccgagacggcagcgaagaagtgtcgccggcagcgttaatgttagc |
43875241 |
T |
 |
| Q |
177 |
tgctttgaagaaatcaatggtggcctgtagtgtggagagtcctgatgatgtaatctccgccgttcatcatccaatggagattggatggcctacaaatgtt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875242 |
tgctttgaagaaatcaatggtggcctgtagtgtggagagtcctgatgatgtaatctccgccgttcatcatccaatggagattggatggcctacaaatgtt |
43875341 |
T |
 |
| Q |
277 |
aagcatgttaaccatgtcacgtttgatcgtttcaatgggtttttgg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43875342 |
aagcatgttaaccatgtcacgtttgatcgtttcaatgggtttttgg |
43875387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University