View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0435_low_13 (Length: 320)

Name: NF0435_low_13
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0435_low_13
NF0435_low_13
[»] chr8 (27 HSPs)
chr8 (78-291)||(39848765-39848978)
chr8 (78-283)||(38633053-38633258)
chr8 (82-252)||(38453535-38453705)
chr8 (79-174)||(38632776-38632871)
chr8 (78-174)||(34533863-34533959)
chr8 (81-157)||(38453906-38453982)
chr8 (166-284)||(34916661-34916779)
chr8 (97-182)||(34533579-34533664)
chr8 (78-174)||(39848486-39848582)
chr8 (96-270)||(34549087-34549261)
chr8 (78-260)||(34538940-34539122)
chr8 (78-174)||(34533725-34533821)
chr8 (87-174)||(39848636-39848723)
chr8 (99-174)||(34916426-34916501)
chr8 (109-157)||(34916581-34916629)
chr8 (109-160)||(34534015-34534066)
chr8 (78-157)||(34544792-34544871)
chr8 (109-164)||(34916298-34916353)
chr8 (230-284)||(34544941-34544995)
chr8 (96-174)||(38632554-38632632)
chr8 (87-161)||(38632648-38632722)
chr8 (100-157)||(36951478-36951535)
chr8 (97-173)||(38632935-38633011)
chr8 (98-161)||(39848368-39848431)
chr8 (97-174)||(34916150-34916227)
chr8 (163-264)||(34534118-34534219)
chr8 (96-157)||(39848267-39848328)
[»] chr4 (1 HSPs)
chr4 (82-252)||(44474635-44474805)
[»] chr3 (1 HSPs)
chr3 (117-284)||(7045712-7045879)
[»] chr6 (1 HSPs)
chr6 (163-264)||(14904775-14904876)
[»] chr2 (5 HSPs)
chr2 (179-264)||(32716860-32716945)
chr2 (205-264)||(32714058-32714117)
chr2 (205-264)||(32716472-32716531)
chr2 (178-264)||(32717273-32717359)
chr2 (179-264)||(32716653-32716738)
[»] chr5 (1 HSPs)
chr5 (203-264)||(2997981-2998042)


Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 27)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 78 - 291
Target Start/End: Original strand, 39848765 - 39848978
Alignment:
78 gattatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgat 177  Q
    |||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39848765 gattatgagttgggttgttggtgatgtcttcgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgat 39848864  T
178 attggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgataaaaaagtgacag 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||    
39848865 attggtaacttcaggagtaaacttctccatgacaatggaaaatacacacactcaaatggaacaatatacgagggtgattgggttgataaaaaagtgacag 39848964  T
278 agaaaggtctgaag 291  Q
    ||||||||||||||    
39848965 agaaaggtctgaag 39848978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 78 - 283
Target Start/End: Original strand, 38633053 - 38633258
Alignment:
78 gattatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgat 177  Q
    |||||||| ||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||    
38633053 gattatgacttgggctactggtgatgtcttcgatggttgttggtcaaatgggcttatacatggatctggagtttatagatatgctaatggggatgtcgat 38633152  T
178 attggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgataaaaaagtgacag 277  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||  | |||||| || | ||||||||||||||||||||    
38633153 attggtaacttcaggagtaaacttctccatgtcaatggaaaatacacatgctcagatggaacaaattgcgagggcgatttggttgataaaaaagtgacag 38633252  T
278 agaaag 283  Q
    ||||||    
38633253 agaaag 38633258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 82 - 252
Target Start/End: Complemental strand, 38453705 - 38453535
Alignment:
82 atgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgatattg 181  Q
    ||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||| || ||||||||||| ||||    
38453705 atgagttgggctaatggtgatgtttttgatggttgttggtcaaatggacttatacatggatctggagtttttagatttgcaaatggggatgtcgacattg 38453606  T
182 gtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggt 252  Q
    ||||||||||||||||||  || |||| ||| ||||||||||||   |||||||||||||| |||||||||    
38453605 gtaacttcaggagtaaacaacttcatggcaacggaaaatacacattttcaaatggaacaatgtacgagggt 38453535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 79 - 174
Target Start/End: Original strand, 38632776 - 38632871
Alignment:
79 attatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtc 174  Q
    ||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| ||| || |||||||||    
38632776 attatgagttgggctactggtgatgtcttcgatggttgttggtcagatggacttatacatggatttggagtttatagatctgcaaatggggatgtc 38632871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 78 - 174
Target Start/End: Complemental strand, 34533959 - 34533863
Alignment:
78 gattatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtc 174  Q
    |||||||| ||||| || ||||||||| ||||||||||||||||||||| |||||| | ||||||||||||||||||||||||| || |||||||||    
34533959 gattatgaattgggttgatggtgatgtttttgatggttgttggtcaaatagacttaaagatggatatggagtttatagatatgcaaatggggatgtc 34533863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 81 - 157
Target Start/End: Complemental strand, 38453982 - 38453906
Alignment:
81 tatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagat 157  Q
    |||||||||| ||| ||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||    
38453982 tatgagttggcctgatggtgatgtttttgatggttgttggtcaaatagacttgtacatggatatggagtttatagat 38453906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 166 - 284
Target Start/End: Complemental strand, 34916779 - 34916661
Alignment:
166 ggggatgtcgatattggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgata 265  Q
    ||||||||| | |||||||| |||| | || |||||||||||| ||  ||||| |||||| |  |||||||||||||||||||||||||||||||||||     
34916779 ggggatgtctacattggtaaattcaagggtgaacttctccatggcatgggaaagtacacatggacaaatggaacaatatacgagggtgactgggttgatg 34916680  T
266 aaaaagtgacagagaaagg 284  Q
     ||||||||||| ||||||    
34916679 gaaaagtgacagggaaagg 34916661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 97 - 182
Target Start/End: Complemental strand, 34533664 - 34533579
Alignment:
97 ggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgatattgg 182  Q
    |||||||| || ||||||||||||| ||||||||||| |||||||| ||||||||||| ||||||||| ||||||||| |||||||    
34533664 ggtgatgttttcgatggttgttggtaaaatggacttaaacatggatctggagtttatacatatgctaatggggatgtctatattgg 34533579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 78 - 174
Target Start/End: Original strand, 39848486 - 39848582
Alignment:
78 gattatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtc 174  Q
    |||||||||||||| | |||| ||||||||  |||||||||||||||||||||||  |||||||||||||||||||||||  || || |||||||||    
39848486 gattatgagttgggatactggagatgtcttctatggttgttggtcaaatggacttgcacatggatatggagtttatagatccgcaaatggggatgtc 39848582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 96 - 270
Target Start/End: Complemental strand, 34549261 - 34549087
Alignment:
96 tggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgatattggt-aacttcaggag 194  Q
    ||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||| | | || ||| ||||| | |||||| || |||| ||     
34549261 tggtgatgtttttgatggttgttggtctaatggacttacacatggatatggagtttatagattttcaaatgggaatgtctacattggtgaatttca-gaa 34549163  T
195 taaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgataaaaaa 270  Q
     || | ||  ||||  || ||||| |||||| | |||||||||||||||||||||| ||| ||||| ||| |||||    
34549162 caatcgtcgtcatggaaaaggaaagtacacatggtcaaatggaacaatatacgaggatgaatgggtcgatgaaaaa 34549087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 78 - 260
Target Start/End: Complemental strand, 34539122 - 34538940
Alignment:
78 gattatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgat 177  Q
    |||||||| |||||||  ||| ||||| ||| |||||||||||||||||||||||| |||||| | |||||||||||||| ||| || ||||||||  |     
34539122 gattatgaattgggctaatggcgatgtttttaatggttgttggtcaaatggacttagacatggttctggagtttatagatttgcaaatggggatgtgtac 34539023  T
178 attggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggt 260  Q
     | || ||||||| |||||| ||| ||||||   | ||||| | |||| | |  |||||||||||||||||||| || |||||    
34539022 ttcggaaacttcaagagtaaccttttccatggacacggaaagttcacatggtggaatggaacaatatacgagggcgattgggt 34538940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 78 - 174
Target Start/End: Complemental strand, 34533821 - 34533725
Alignment:
78 gattatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtc 174  Q
    ||||||||| ||||||  ||||| ||| || ||||||||||||||||||||||||| ||||||||||||||||| ||||| | | || |||||||||    
34533821 gattatgagatgggctaatggtgttgttttcgatggttgttggtcaaatggacttagacatggatatggagtttgtagatttacaaatggggatgtc 34533725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 87 - 174
Target Start/End: Original strand, 39848636 - 39848723
Alignment:
87 ttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtc 174  Q
    |||||||  ||||||||| ||||||||||||  |||||||||||||| |||||||| |||||||||||||| ||| || |||||||||    
39848636 ttgggctaatggtgatgtttttgatggttgtatgtcaaatggacttagacatggatttggagtttatagatttgcaaatggggatgtc 39848723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 34916501 - 34916426
Alignment:
99 tgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtc 174  Q
    |||||| || ||||||| |||||||||||||| || ||||||||||||||||||||||| ||| || |||||||||    
34916501 tgatgttttcgatggttattggtcaaatggacataaacatggatatggagtttatagatttgcaaatggggatgtc 34916426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 34916629 - 34916581
Alignment:
109 gatggttgttggtcaaatggacttatacatggatatggagtttatagat 157  Q
    ||||||||||||||||||||||||  |||||||||||||||||||||||    
34916629 gatggttgttggtcaaatggactttcacatggatatggagtttatagat 34916581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 109 - 160
Target Start/End: Complemental strand, 34534066 - 34534015
Alignment:
109 gatggttgttggtcaaatggacttatacatggatatggagtttatagatatg 160  Q
    ||||||||||||||||||||||||| ||||||| |||| |||||||||||||    
34534066 gatggttgttggtcaaatggacttaaacatggacatggggtttatagatatg 34534015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 78 - 157
Target Start/End: Complemental strand, 34544871 - 34544792
Alignment:
78 gattatgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagat 157  Q
    |||||||| ||||| |  ||||||||| ||  |||| |||||||||||||||| || |||||||||||||||||||||||    
34544871 gattatgaattgggttaatggtgatgttttcaatggatgttggtcaaatggacatagacatggatatggagtttatagat 34544792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 109 - 164
Target Start/End: Complemental strand, 34916353 - 34916298
Alignment:
109 gatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaa 164  Q
    ||||||| ||||||||||||||||  ||||||||||||||||||||||| ||||||    
34916353 gatggttattggtcaaatggactttcacatggatatggagtttatagatctgctaa 34916298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 230 - 284
Target Start/End: Complemental strand, 34544995 - 34544941
Alignment:
230 caaatggaacaatatacgagggtgactgggttgataaaaaagtgacagagaaagg 284  Q
    |||||||||||||||||||||||||||||||||||  |||| |||||| ||||||    
34544995 caaatggaacaatatacgagggtgactgggttgatggaaaaatgacagggaaagg 34544941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 38632554 - 38632632
Alignment:
96 tggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtc 174  Q
    ||||||||| || |||| ||||||||||||||||||| ||||||||| |||||||| ||||  ||| || |||||||||    
38632554 tggtgatgttttggatgcttgttggtcaaatggacttctacatggatttggagtttttagagctgcaaatggggatgtc 38632632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 87 - 161
Target Start/End: Original strand, 38632648 - 38632722
Alignment:
87 ttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgc 161  Q
    |||||||| ||||||||  ||||||||||||   ||||||||| ||| |||||||| ||||||||||||||||||    
38632648 ttgggctgatggtgatgcttttgatggttgtctatcaaatggatttagacatggatttggagtttatagatatgc 38632722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 100 - 157
Target Start/End: Original strand, 36951478 - 36951535
Alignment:
100 gatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagat 157  Q
    ||||| |||||||||||||||| ||||||||||| ||| |||| ||||||||||||||    
36951478 gatgtttttgatggttgttggttaaatggacttagacaaggatctggagtttatagat 36951535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 97 - 173
Target Start/End: Original strand, 38632935 - 38633011
Alignment:
97 ggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgt 173  Q
    |||||||| |||||||||| || |||||||||||||| | |||||| ||||||||||| || ||| || ||||||||    
38632935 ggtgatgtttttgatggttatttgtcaaatggacttagatatggatttggagtttataaatttgcaaatggggatgt 38633011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 98 - 161
Target Start/End: Original strand, 39848368 - 39848431
Alignment:
98 gtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgc 161  Q
    ||||||| |||||||||||| | |||| ||  ||||||||||||| ||||||||||||||||||    
39848368 gtgatgtttttgatggttgtcgatcaattgcgcttatacatggatttggagtttatagatatgc 39848431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 34916227 - 34916150
Alignment:
97 ggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtc 174  Q
    |||||||| || ||||||| ||||||||||||||  | |||||| |||||||||||||||| ||| || || ||||||    
34916227 ggtgatgttttcgatggttattggtcaaatggacagaaacatggctatggagtttatagatttgcaaatggagatgtc 34916150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 264
Target Start/End: Complemental strand, 34534219 - 34534118
Alignment:
163 aacggggatgtcgatattggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttg 262  Q
    |||||||||||| | ||||||||||||| | || |||||   |||| ||| || || |||||| | ||| ||||||||||||| ||||| || |||||||    
34534219 aacggggatgtctacattggtaacttcaagggtgaactttgtcatggcaacgggaagtacacatggtcagatggaacaatatatgagggcgattgggttg 34534120  T
263 at 264  Q
    ||    
34534119 at 34534118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 96 - 157
Target Start/End: Original strand, 39848267 - 39848328
Alignment:
96 tggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagat 157  Q
    ||||||||| ||| ||||||||||||||||||   || || ||||||||||||||| |||||    
39848267 tggtgatgtttttaatggttgttggtcaaatgactttgtatatggatatggagtttttagat 39848328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 82 - 252
Target Start/End: Original strand, 44474635 - 44474805
Alignment:
82 atgagttgggctgctggtgatgtctttgatggttgttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgatattg 181  Q
    ||||||||| ||  ||||||||| ||||| ||||| ||||||||||||||||||||||||| |||||||| || || ||| || ||||||||||| ||||    
44474635 atgagttggactaatggtgatgtttttgaaggttgctggtcaaatggacttatacatggatctggagtttttaaatttgcaaatggggatgtcgacattg 44474734  T
182 gtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggt 252  Q
    ||||||||||||||||||||||  ||||||| |||| ||||||| | ||||||| |||||| ||| |||||    
44474735 gtaacttcaggagtaaacttctttatgacaacggaacatacacatgttcaaatgaaacaatgtacaagggt 44474805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 117 - 284
Target Start/End: Complemental strand, 7045879 - 7045712
Alignment:
117 ttggtcaaatggacttatacatggatatggagtttatagatatgctaacggggatgtcgatattggtaacttcaggagtaaacttctccatgacaatgga 216  Q
    ||||||||||||||||||||||||||||||||||| || || ||| || || |||||| | ||||||||||| | |||| |||||||| ||||||| |||    
7045879 ttggtcaaatggacttatacatggatatggagtttttacatttgcaaatggagatgtcaacattggtaactttaagagtcaacttctctatgacaacgga 7045780  T
217 aaatacacacgctcaaatggaacaatatacgagggtgactgggttgataaaaaagtgacagagaaagg 284  Q
    || | |||| | |||||||||||||| ||||| ||  | || |||||| ||||||||| |||||||||    
7045779 aagtgcacatggtcaaatggaacaatgtacgaaggccattgtgttgatgaaaaagtgatagagaaagg 7045712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 264
Target Start/End: Complemental strand, 14904876 - 14904775
Alignment:
163 aacggggatgtcgatattggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttg 262  Q
    |||||||||||| | ||||||||||||| || | | ||| |||||| ||| |||||||||||| | || ||||||| |||||| |||||||| |||||||    
14904876 aacggggatgtctacattggtaacttcaagaatgatcttttccatggcaaaggaaaatacacatggtcgaatggaaaaatatatgagggtgattgggttg 14904777  T
263 at 264  Q
    ||    
14904776 at 14904775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 32716860 - 32716945
Alignment:
179 ttggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgat 264  Q
    |||||||||||  |||| | ||| |||||| ||| ||||| |||||| | ||| |||||||||||||||| ||||| |||||||||    
32716860 ttggtaacttcgagagtgatcttttccatggcaaaggaaagtacacatggtcacatggaacaatatacgatggtgattgggttgat 32716945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 205 - 264
Target Start/End: Original strand, 32714058 - 32714117
Alignment:
205 catgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgat 264  Q
    |||| ||| ||||| |||||| | ||||||||||||||||| |||||||| |||||||||    
32714058 catggcaagggaaagtacacatggtcaaatggaacaatatatgagggtgattgggttgat 32714117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 205 - 264
Target Start/End: Original strand, 32716472 - 32716531
Alignment:
205 catgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgat 264  Q
    |||| ||| ||||| |||||| | ||||||||||||||||| |||||||| |||||||||    
32716472 catggcaagggaaagtacacatggtcaaatggaacaatatatgagggtgattgggttgat 32716531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 264
Target Start/End: Original strand, 32717273 - 32717359
Alignment:
178 attggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgat 264  Q
    ||||||||||||  |||| | |||  ||||| ||| ||||| |||||| | | | |||||||||||||||||||||| |||||||||    
32717273 attggtaacttcgagagtgatctttaccatggcaaaggaaagtacacatggttagatggaacaatatacgagggtgattgggttgat 32717359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 32716653 - 32716738
Alignment:
179 ttggtaacttcaggagtaaacttctccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgat 264  Q
    |||||||||||  |||| | ||| |||||| ||| ||||| |||||  | | ||||||||||||||| |||||||| |||||||||    
32716653 ttggtaacttcgagagtgatcttttccatggcaagggaaagtacacgtggttaaatggaacaatatatgagggtgattgggttgat 32716738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 203 - 264
Target Start/End: Original strand, 2997981 - 2998042
Alignment:
203 tccatgacaatggaaaatacacacgctcaaatggaacaatatacgagggtgactgggttgat 264  Q
    |||||| ||| ||||| |||||| | |||| |||||||||||| |||||||| |||||||||    
2997981 tccatggcaagggaaagtacacatggtcaagtggaacaatatatgagggtgattgggttgat 2998042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University