View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_14 (Length: 317)
Name: NF0435_low_14
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0435_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 91 - 215
Target Start/End: Complemental strand, 3811170 - 3811046
Alignment:
Q |
91 |
ctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaacatagctcattaatgtaattttcatggatattgataacttcaaccgataaca |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3811170 |
ctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaatgtaattttcatggatattgataacttcaaccgataaca |
3811071 |
T |
 |
Q |
191 |
aacccttttaagagtaatgaatttg |
215 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
3811070 |
aacccttttaagagtaatgaatttg |
3811046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University