View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_15 (Length: 316)
Name: NF0435_low_15
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0435_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 84 - 218
Target Start/End: Complemental strand, 6281839 - 6281705
Alignment:
Q |
84 |
cagagacagaatttgaaaagttatgcaaatgttctggattttctagttttgaggttgtttgtcttgccttttctgccctaggagtgatggaattttctaa |
183 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6281839 |
cagagaaagaatttgaaaagttatgcaaatgttctggattttctagttttgaggttgtttgtcttgccttttctgccctaggagtgatggaattttctaa |
6281740 |
T |
 |
Q |
184 |
ataaataagcaagtattatgtaaggaatataatag |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
6281739 |
ataaataagcaagtattatgtaaggaatataatag |
6281705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 54 times since January 2019
Visitors: 3243