View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_17 (Length: 290)
Name: NF0435_low_17
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0435_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 59 - 227
Target Start/End: Original strand, 32879243 - 32879411
Alignment:
| Q |
59 |
aacgtcaacttgattggcaaaacaaataaagaagaatttaaaaggttcttgtcaacgtgtcctcttgagacactttttaaggattgcaaaatataaatta |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32879243 |
aacgtcaacttgattggcaaaacaaataaagaagaatttaaaagattcttgtcaacgtgtgctcttgaggcactttttaaggattgcaaaatataaatta |
32879342 |
T |
 |
| Q |
159 |
ttcttaagagcactagttagcataatctaaaataaaatatcttttttcttaaaacacacaactactatt |
227 |
Q |
| |
|
|||||||||||||| |||| ||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32879343 |
ttcttaagagcacttgttaacataacctaacataaaatatcttttttcttaaaacacacaactactatt |
32879411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University