View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0435_low_17 (Length: 290)

Name: NF0435_low_17
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0435_low_17
NF0435_low_17
[»] chr1 (1 HSPs)
chr1 (59-227)||(32879243-32879411)


Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 59 - 227
Target Start/End: Original strand, 32879243 - 32879411
Alignment:
59 aacgtcaacttgattggcaaaacaaataaagaagaatttaaaaggttcttgtcaacgtgtcctcttgagacactttttaaggattgcaaaatataaatta 158  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||    
32879243 aacgtcaacttgattggcaaaacaaataaagaagaatttaaaagattcttgtcaacgtgtgctcttgaggcactttttaaggattgcaaaatataaatta 32879342  T
159 ttcttaagagcactagttagcataatctaaaataaaatatcttttttcttaaaacacacaactactatt 227  Q
    |||||||||||||| |||| ||||| |||| ||||||||||||||||||||||||||||||||||||||    
32879343 ttcttaagagcacttgttaacataacctaacataaaatatcttttttcttaaaacacacaactactatt 32879411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University