View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_18 (Length: 283)
Name: NF0435_low_18
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0435_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 205 - 255
Target Start/End: Complemental strand, 26328190 - 26328140
Alignment:
| Q |
205 |
gatagttaattctctatttatctataagaaacttgaaagattatcatttgt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26328190 |
gatagttaattctctatttatctataagaaacctgaaagattatcatttgt |
26328140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 51
Target Start/End: Complemental strand, 26328385 - 26328346
Alignment:
| Q |
12 |
agctgttgctagttcatagtattagtatactccaatcaaa |
51 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26328385 |
agctgttgctagttcatagtatcagtatactccaatcaaa |
26328346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 106 - 135
Target Start/End: Complemental strand, 26328291 - 26328262
Alignment:
| Q |
106 |
atggagcattgctttcacatgtttacaagt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26328291 |
atggagcattgctttcacatgtttacaagt |
26328262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 303 times since January 2019
Visitors: 3263