View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_20 (Length: 282)
Name: NF0435_low_20
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0435_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 47 - 240
Target Start/End: Original strand, 38359987 - 38360180
Alignment:
| Q |
47 |
aaaatcacctgaaacttttcatgttttttggacatcataaggatagctgaaagaaattggtccccgcattgtagattggttgctctatctgccataattc |
146 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
38359987 |
aaaatcacctgaaacttttcaagttttttggacatcataaggatagctaaaagaaattggtccccacaatgtagactggttgctctatctgccataattc |
38360086 |
T |
 |
| Q |
147 |
acttcttcaacaccaactggttttgcataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatcacagg |
240 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38360087 |
actgcttcaacaccatctggttttgcataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatctcagg |
38360180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University