View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_22 (Length: 275)
Name: NF0435_low_22
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0435_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 49 - 225
Target Start/End: Complemental strand, 10896099 - 10895924
Alignment:
| Q |
49 |
atgacagaaagaaggtttagagttatttttctgtgataaccctaaaataccaatgcaatagttcgtcttaagggtattttggggattttggattcgaaac |
148 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
10896099 |
atgacagaaagaaggtttagagttctttttctgtaataaccctaaaataccaatgcaacagttcgttttaagggtattttgggga-tttggattagaaac |
10896001 |
T |
 |
| Q |
149 |
agcatagtgcaaatatagtgccactccagtggtgaaacgcagcatgatttccagccgctactcaattcctcgctgca |
225 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||| |||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10896000 |
agcatagtgcaactgtagtgccactctagtggtaaaacacgacatgatttccagccgctactcaattcctcgctgca |
10895924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 33 - 224
Target Start/End: Complemental strand, 10951374 - 10951184
Alignment:
| Q |
33 |
agcagagacgctcggaatgacagaaagaaggtttagagttatttttctgtgataaccctaaaataccaatgcaatagttcgtcttaagggtattttgggg |
132 |
Q |
| |
|
|||||||||| || |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
10951374 |
agcagagacgttcagaatgacagaaagaaggtctagagttctttttctgtgataaccctaaaataccaatgcaacggttcgctttaagggtattgtgggg |
10951275 |
T |
 |
| Q |
133 |
attttggattcgaaacagcatagtgcaaatatagtgccactccagtggtgaaacgcagcatgatttccagccgctactcaattcctcgctgc |
224 |
Q |
| |
|
|||||||||| ||||||| || |||||| | ||||||||||||||||||||||| | |||||||||||| || |||||||||||| ||||| |
|
|
| T |
10951274 |
attttggattagaaacagaatggtgcaactgtagtgccactccagtggtgaaacacgacatgatttccag-cgttactcaattccttgctgc |
10951184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University