View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_25 (Length: 259)
Name: NF0435_low_25
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0435_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 50 - 113
Target Start/End: Complemental strand, 4263524 - 4263461
Alignment:
| Q |
50 |
gaacctgtgaagcacggacgctcttttggttgaactgaggttgaattgcagttggtccaattgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4263524 |
gaacctgtgaagcacggacgctcttttggttgaactgaggttgaattgcagttggttcaattgg |
4263461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 164 - 224
Target Start/End: Complemental strand, 4263410 - 4263352
Alignment:
| Q |
164 |
gtcatccagttcaagcatatggttgaatcaattttaccatgatacataggtctcacaggtt |
224 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4263410 |
gtcatccagttcaagcat--ggttgaatcaattttaccatgatacataggtctcacaggtt |
4263352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University