View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_26 (Length: 258)
Name: NF0435_low_26
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0435_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 37 - 232
Target Start/End: Original strand, 34071437 - 34071633
Alignment:
Q |
37 |
acgagggagtggcttgaggtttactttggttcaacgaattaacttctataacaaatgccatacatgagtttgattccaaaatggttgtgaattgtttcaa |
136 |
Q |
|
|
||||||||| |||||||||||||||||||||| ||||||||||| |||||||| ||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
T |
34071437 |
acgagggagcggcttgaggtttactttggttcgacgaattaactcttataacaa-tgccatatatgagtttgattctaagatggttgtgaattgtttcaa |
34071535 |
T |
 |
Q |
137 |
tcatctacgtacgaatatgtcaaaatttggctttatattacaatatt--taatttggcttaaagtcatgtttagtccaaacaaattggttagcaaaca |
232 |
Q |
|
|
|| |||| ||||| |||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
T |
34071536 |
tcttctatgtacggatatctcaaaatttaactttatattacaatatttataatttggcttaaagtcatgtttagtccaaacgaattggttggcaaaca |
34071633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1663 times since January 2019
Visitors: 3233