View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0435_low_31 (Length: 213)
Name: NF0435_low_31
Description: NF0435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0435_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 10194142 - 10194264
Alignment:
| Q |
1 |
ctggtattgcaatttgtcataaactgcatcgcatcaattgcattcactgcaacatggaacttatcaaaattttctgtccctaacaccattccgggcatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10194142 |
ctggtattgcaatttgtcataaact-----gaatcaattgcattcactgcaacatggaacttatcaaaattttctgtccctaacaccattccaggcatcc |
10194236 |
T |
|
| Q |
101 |
tgatatcaggatcaaggaattcgaactc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10194237 |
tgatatcaggatcaaggaattcgaactc |
10194264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 61 times since January 2019
Visitors: 3244