View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0436_high_8 (Length: 235)

Name: NF0436_high_8
Description: NF0436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0436_high_8
NF0436_high_8
[»] chr4 (1 HSPs)
chr4 (1-222)||(27939600-27939821)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 27939600 - 27939821
Alignment:
1 gagagaacaaggaggagaatgaggaatcgaggctgagcgagaaacgcgatctctctacgcattgcttcagcacagtatttggtcagtttataccgaatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27939600 gagagaacaaggaggagaatgaggaatcgaggctgagcgagaaacgcgatctctctacgcattgcttcagcacagtatttggtcagtttataccgaatca 27939699  T
101 gagaaaaatcgaaactttgatattctccatggaaggtagcttagtgggtttttgtcaacattgaaaggggtaaaggaaaacgtgggacactttctcagtt 200  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
27939700 gagaaaaatcgaaactttgatattctccatagaaggtagcttagtgggtttttgtcaacattgaaaggggtaaaggaaaacgtgggacactttctcagtg 27939799  T
201 gagattttttggtgatgatgtc 222  Q
    ||||||||||||||||||||||    
27939800 gagattttttggtgatgatgtc 27939821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1537 times since January 2019
Visitors: 3232