View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0436_high_9 (Length: 211)
Name: NF0436_high_9
Description: NF0436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0436_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 6753152 - 6753041
Alignment:
Q |
1 |
ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6753152 |
ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg |
6753053 |
T |
 |
Q |
101 |
agcttcagaaat |
112 |
Q |
|
|
|||||||||||| |
|
|
T |
6753052 |
agcttcagaaat |
6753041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 1811382 - 1811493
Alignment:
Q |
1 |
ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
1811382 |
ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatacctccagagtgtccacg |
1811481 |
T |
 |
Q |
101 |
agcttcagaaat |
112 |
Q |
|
|
|||||||||||| |
|
|
T |
1811482 |
agcttcagaaat |
1811493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University