View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0436_low_15 (Length: 250)
Name: NF0436_low_15
Description: NF0436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0436_low_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 30 - 250
Target Start/End: Complemental strand, 2353048 - 2352828
Alignment:
| Q |
30 |
agattaaagtcatcatgtgcaaagttatgatagttaatgatcctattgtggcatgtctacatcagtgccacatttgatatgtaatgtcactttcttgtag |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2353048 |
agattaaagtcatcatgtgcaaagttatgatagttaatgatcctattgtggcatgtctacatcggtgccacatttgatatgtaatgtcactttcttgtag |
2352949 |
T |
|
| Q |
130 |
atcgaggatgggatgtttgatatattctgagaaaaaaccctggcctgcataattgtcttatctacaatacaactaagattttttaaactctaacgtataa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2352948 |
atcgaggatgggatgtttgatatattctgagaaaaaaccctggcctgcataattgtcttatctacaatacaactaagattttttaaactctaacgtataa |
2352849 |
T |
|
| Q |
230 |
tcaaacccacttggtgcttac |
250 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2352848 |
tcaaacccacttggtgcttac |
2352828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 228 times since January 2019
Visitors: 3261