View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0436_low_19 (Length: 211)

Name: NF0436_low_19
Description: NF0436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0436_low_19
NF0436_low_19
[»] chr2 (1 HSPs)
chr2 (1-112)||(6753041-6753152)
[»] chr4 (1 HSPs)
chr4 (1-112)||(1811382-1811493)


Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 6753152 - 6753041
Alignment:
1 ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6753152 ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg 6753053  T
101 agcttcagaaat 112  Q
    ||||||||||||    
6753052 agcttcagaaat 6753041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 1811382 - 1811493
Alignment:
1 ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
1811382 ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatacctccagagtgtccacg 1811481  T
101 agcttcagaaat 112  Q
    ||||||||||||    
1811482 agcttcagaaat 1811493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 210 times since January 2019
Visitors: 3261