View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0436_low_20 (Length: 201)
Name: NF0436_low_20
Description: NF0436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0436_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 11 - 115
Target Start/End: Complemental strand, 19962499 - 19962396
Alignment:
Q |
11 |
cagagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggaggtgatacggggggtaggggaggaagctgaggaaaggaagat |
110 |
Q |
|
|
||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||| ||||||||| ||||||||||| |||| ||||||||||| ||| |
|
|
T |
19962499 |
cagagacggttgcagtagagacaaaacgaccaaagttggtgccgccatggatgatggtggtgatacg-ggggtaggggaagaaggtgaggaaaggatgat |
19962401 |
T |
 |
Q |
111 |
gaaga |
115 |
Q |
|
|
||||| |
|
|
T |
19962400 |
gaaga |
19962396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 11 - 83
Target Start/End: Complemental strand, 1971487 - 1971415
Alignment:
Q |
11 |
cagagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggaggtgatacggggggt |
83 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
T |
1971487 |
cagagacggttgcagcggagacaaaacgaccaaaattgatgccgccatggatgatggtggtgatacggagggt |
1971415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 78 - 115
Target Start/End: Complemental strand, 1971400 - 1971363
Alignment:
Q |
78 |
gggggtaggggaggaagctgaggaaaggaagatgaaga |
115 |
Q |
|
|
|||||||||||| |||| |||||||||||||||||||| |
|
|
T |
1971400 |
gggggtaggggaagaaggtgaggaaaggaagatgaaga |
1971363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University