View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0436_low_8 (Length: 325)
Name: NF0436_low_8
Description: NF0436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0436_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 85 - 237
Target Start/End: Complemental strand, 44821368 - 44821216
Alignment:
Q |
85 |
cagagacagtgtttggtgaaggtgtagtagtggatttggtgagccagatagtgaaagatgaaaggaaggagatggaagaaaagagtgtgaatgtaaagag |
184 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
44821368 |
cagagacagtgtttggtgaaggtgtagtagtggatttggtgagccagatagtgaaagatgaaaggaagaagatggaagaaaagagtgtgaatgtaaagag |
44821269 |
T |
 |
Q |
185 |
taaaagtcaagtgggtttgaaagagaaacttctttgtctctccattgatgatg |
237 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44821268 |
taaaagtctagtgggtttgaaagagaaacttctttgtctctccattgatgatg |
44821216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University