View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_high_17 (Length: 258)
Name: NF0437_high_17
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0437_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 75 - 208
Target Start/End: Complemental strand, 11933548 - 11933415
Alignment:
| Q |
75 |
gtgagatgaaggtcgtggtcggcgtgaggaaaaagaggaggccgcaatgtataatgtcagatctgaaaggtcagcggtggttgcacttgcacctttcgtc |
174 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
11933548 |
gtgagatgaaggtcgtggtcggcgcgaagaaaaagaggaggccgcgatgtataatgtcagatctgtaaggtcagtggtggttgcacttgcacctttcgtc |
11933449 |
T |
 |
| Q |
175 |
gaaattctttctgacctggtctctctcaccggtg |
208 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
11933448 |
ggaattctttctgacctggtctctctcaccggtg |
11933415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 76 - 168
Target Start/End: Original strand, 35237366 - 35237459
Alignment:
| Q |
76 |
tgagatgaaggtcgtggtcggcgtgaggaaaaagaggaggccgcaatgtat-aatgtcagatctgaaaggtcagcggtggttgcacttgcacct |
168 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||| | | ||| || |||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
35237366 |
tgagatgaaggtcgtggtcggcgtgagggaaaggaggaggtcacgatggatcaatgtcagatctgaaaggatggtggtggttgcacttgcacct |
35237459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University