View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_low_16 (Length: 325)
Name: NF0437_low_16
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0437_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 89 - 259
Target Start/End: Original strand, 4610796 - 4610966
Alignment:
Q |
89 |
gtaaccaagtggtttacatctagtaaagaatttggtttggtttcttttaaagaatacaactctgtactcatagcaattgttatcagtaccttacgataca |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4610796 |
gtaaccaagtggtttacatctagtaaagaatttggtttggtttcttttaaagaatacaactctgtactcatagcaattgttatcagtaccttacgataca |
4610895 |
T |
 |
Q |
189 |
cgccattcatatctcatttcaatgcagaactagatcgaatcaatacgaatttctaatgtgtatcgcgagcc |
259 |
Q |
|
|
|| | || ||||||||||||||||| |||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
T |
4610896 |
tgcgactcgtatctcatttcaatgcaaaactggatcaaatcaatacgaatttctagtgtgtatcgcgagcc |
4610966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 4610997 - 4611049
Alignment:
Q |
263 |
atggtaaatcatgattcattctaatggtttcctttgtcaagttatttcctatg |
315 |
Q |
|
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
T |
4610997 |
atggtaaatcatgatttattttaatggtttcctttgtcaagttatttcctatg |
4611049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 82 times since January 2019
Visitors: 3244