View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_low_19 (Length: 313)
Name: NF0437_low_19
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0437_low_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 92 - 313
Target Start/End: Original strand, 49201496 - 49201717
Alignment:
| Q |
92 |
gttatttcatgaattatgcatgctatcaataaaataaccacaatgtgatgtaatcatatggatctcatggatcatattaacaaattttttgtttgatgga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49201496 |
gttatttcatgaattatgcatgctatcaatataataaccacaatgtgatgtaatcatatggatctcatggatcatattaacaaattttttgtttgatgga |
49201595 |
T |
 |
| Q |
192 |
tggattggatggatcatatcattgatgttagtccctgtcaagagttttgttttaaacaccaaaagtgcattcnnnnnnntaccatgcatgtaaaaatgta |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49201596 |
tggattggatggatcatatcattgatgttagtccctgtcaagagttttgttttaaacaccaaaagtgcattcaaaaaaataccatgcatgtaaaaatgta |
49201695 |
T |
 |
| Q |
292 |
aattaaattgtcatataacata |
313 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49201696 |
aattaaattgtcatataacata |
49201717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Original strand, 14371 - 14410
Alignment:
| Q |
167 |
attaacaaatttt-ttgtttgatggatggattggatggat |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14371 |
attaacaaatttttttgtttgatggatggattggatggat |
14410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Original strand, 35049084 - 35049123
Alignment:
| Q |
167 |
attaacaaatttt-ttgtttgatggatggattggatggat |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35049084 |
attaacaaatttttttgtttgatggatggattggatggat |
35049123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 5708212 - 5708173
Alignment:
| Q |
167 |
attaacaaatttttt-gtttgatggatggattggatggat |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5708212 |
attaacaaatttttttgtttgatggatggattggatggat |
5708173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Original strand, 8933893 - 8933932
Alignment:
| Q |
167 |
attaacaaatttt-ttgtttgatggatggattggatggat |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8933893 |
attaacaaatttttttgtttgatggatggattggatggat |
8933932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 9821478 - 9821439
Alignment:
| Q |
167 |
attaacaaatt-ttttgtttgatggatggattggatggat |
205 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9821478 |
attaacaaattattttgtttgatggatggattggatggat |
9821439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 14196617 - 14196578
Alignment:
| Q |
167 |
attaacaaat-tttttgtttgatggatggattggatggat |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14196617 |
attaacaaatatttttgtttgatggatggattggatggat |
14196578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 202
Target Start/End: Original strand, 19967118 - 19967147
Alignment:
| Q |
173 |
aaattttttgtttgatggatggattggatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19967118 |
aaattttttgtttgatggatggattggatg |
19967147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 5375639 - 5375600
Alignment:
| Q |
167 |
attaacaaatttttt-gtttgatggatggattggatggat |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5375639 |
attaacaaatttttttgtttgatggatggattggatggat |
5375600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 205
Target Start/End: Complemental strand, 43323800 - 43323771
Alignment:
| Q |
176 |
ttttttgtttgatggatggattggatggat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43323800 |
ttttttgtttgatggatggattggatggat |
43323771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 25275181 - 25275142
Alignment:
| Q |
167 |
attaacaaatttttt-gtttgatggatggattggatggat |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25275181 |
attaacaaatttttttgtttgatggatggattggatggat |
25275142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 205
Target Start/End: Original strand, 18264571 - 18264600
Alignment:
| Q |
176 |
ttttttgtttgatggatggattggatggat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18264571 |
ttttttgtttgatggatggattggatggat |
18264600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University