View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_low_22 (Length: 293)
Name: NF0437_low_22
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0437_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 96 - 221
Target Start/End: Original strand, 14117863 - 14117988
Alignment:
| Q |
96 |
caattttgtgctcggaatcaatccactgagaaacaatctttgctcttccataaactgattctatagtaaaagttttttcagtaaagtatccaacaaattt |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14117863 |
caattttgtgcttggaatcaatccactgagaaacaatctttgctcttccataaactgattctatagtaaaagttttttcagtaaagtatccaacaaattt |
14117962 |
T |
|
| Q |
196 |
gatttcatcaaaaaatattgctctct |
221 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
14117963 |
gatttcatcaacaaatattgctctct |
14117988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 14129418 - 14129502
Alignment:
| Q |
92 |
tcatcaattttgtgctcggaatcaatccactgagaaacaatctttgctcttccataaactgattctatagtaaaagttttttcag |
176 |
Q |
| |
|
|||||||||| | | || |||||| |||||||||||||| | ||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
14129418 |
tcatcaatttggggttcagaatcagcccactgagaaacaacccttgctcttccataaactgattctatagcaaaagtcttttcag |
14129502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 159
Target Start/End: Original strand, 14121420 - 14121456
Alignment:
| Q |
123 |
gagaaacaatctttgctcttccataaactgattctat |
159 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
14121420 |
gagaaacaacccttgctcttccataaactgattctat |
14121456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 43 times since January 2019
Visitors: 3242