View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_low_23 (Length: 292)
Name: NF0437_low_23
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0437_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 72 - 238
Target Start/End: Original strand, 37841705 - 37841871
Alignment:
Q |
72 |
aaaacagcatcattctatgcttatagtgtttgtaatttgcagtagagggtgtagacaaggaagtgtacctttacctagctacttgggacaaaaataaaat |
171 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
37841705 |
aaaacagcatcattctatgcttatagtgtttgtaatttgcagtagagggtgtagacaaggaagtgtacctttacctagctacttgggacagaaataaaat |
37841804 |
T |
 |
Q |
172 |
acatacaatagtttatgttttagtggaataaatgtcagtgtcaatacatattgtacatgggatcgaa |
238 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37841805 |
acatacaataatttatgttttagtggaataaatgtcagtgtcaatacatattgtacatgggatcgaa |
37841871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University