View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_low_26 (Length: 286)
Name: NF0437_low_26
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0437_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 89 - 258
Target Start/End: Complemental strand, 20363551 - 20363382
Alignment:
| Q |
89 |
ctctttttgtcaattttgtttagccgaacacttgtgttttgtcatttgatttcagacttgactcttgaattatcgaggttggctagacctccaataaaac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20363551 |
ctctttttgtcaattttgtttagccgaacacttgtgttttgtcatttgatttcagacttgactcttgaattatcgaggttggctagacctccaataaaat |
20363452 |
T |
|
| Q |
189 |
ttgtggacgtctaggctaactagttcgatatggaatcatggatatcttttattgcacttctgtcttctct |
258 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20363451 |
ttgtgaacgtctaggctaactagttcgatatggaatcatggatatcttttattgcatttctgtcttctct |
20363382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 95 - 168
Target Start/End: Original strand, 1402445 - 1402518
Alignment:
| Q |
95 |
ttgtcaattttgtttagccgaacacttgtgttttgtcatttgatttcagacttgactcttgaattatcgaggtt |
168 |
Q |
| |
|
||||||||||||| ||||| ||||||| | |||||||||||||||| | ||||| ||||||| ||| |||||| |
|
|
| T |
1402445 |
ttgtcaattttgtatagccaaacacttttattttgtcatttgatttatggcttgaatcttgaactatagaggtt |
1402518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 92 - 161
Target Start/End: Complemental strand, 10931677 - 10931608
Alignment:
| Q |
92 |
tttttgtcaattttgtttagccgaacacttgtgttttgtcatttgatttcagacttgactcttgaattat |
161 |
Q |
| |
|
|||||||||||||||| ||||| || |||| | |||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
10931677 |
tttttgtcaattttgtatagccaaatacttttcttttgtcacttgatttagtacttgaatcttgaattat |
10931608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1474 times since January 2019
Visitors: 3230