View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_low_28 (Length: 275)
Name: NF0437_low_28
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0437_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 45 - 243
Target Start/End: Original strand, 46731793 - 46731984
Alignment:
| Q |
45 |
acatcatcaatagttgtaatattttgtctatattatctgtgcaatgtgcatactgaatgataatagaaccaaaaaaggtacggatattttgccttatgtc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46731793 |
acatcatcaatagttgtaatattttgtctatattatctgtg-------catactgaatgataatagaaccaaaaaaggtacggatattttgccttatgtc |
46731885 |
T |
|
| Q |
145 |
tttgattgtcatatatcacctctactggcagaggtcgttatctttgtgcactccaaaacaaatctgaccctctgccgtgccgtgctgttctgtgctgct |
243 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46731886 |
tttgattgtcatatatcacttctactggcagaggttgttatctttgtgcactccaaaacaaatctgaccctctgccgtgccgtgctgttctgttctgct |
46731984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 97 times since January 2019
Visitors: 3244