View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_low_32 (Length: 264)
Name: NF0437_low_32
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0437_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 42010418 - 42010321
Alignment:
| Q |
30 |
gcttttgaatcttgtaaagctgaggagataaacgtgatgaagacgatgatgatgacgacattggtgtttcagccaatactcgagccacaggttctgct |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42010418 |
gcttttgaatcttgtaaagccgaggagataaacgtgatgaagacgatgatgatgacggcattggtgtttcagccaatactcgagccacagtttctgct |
42010321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 1245756 - 1245659
Alignment:
| Q |
30 |
gcttttgaatcttgtaaagctgaggagataaacgtgatgaagacgatgatgatgacgacattggtgtttcagccaatactcgagccacaggttctgct |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1245756 |
gcttttgaatcttgtaaagccgaggagataaacgtgatgaagacgataaagatgacggcattggtgtttcagccaatactcgagccacagtttctgct |
1245659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1527 times since January 2019
Visitors: 3232