View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0437_low_33 (Length: 258)

Name: NF0437_low_33
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0437_low_33
NF0437_low_33
[»] chr1 (1 HSPs)
chr1 (75-208)||(11933415-11933548)
[»] chr3 (1 HSPs)
chr3 (76-168)||(35237366-35237459)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 75 - 208
Target Start/End: Complemental strand, 11933548 - 11933415
Alignment:
75 gtgagatgaaggtcgtggtcggcgtgaggaaaaagaggaggccgcaatgtataatgtcagatctgaaaggtcagcggtggttgcacttgcacctttcgtc 174  Q
    |||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||    
11933548 gtgagatgaaggtcgtggtcggcgcgaagaaaaagaggaggccgcgatgtataatgtcagatctgtaaggtcagtggtggttgcacttgcacctttcgtc 11933449  T
175 gaaattctttctgacctggtctctctcaccggtg 208  Q
    | ||||||||||||||||||||||||||||||||    
11933448 ggaattctttctgacctggtctctctcaccggtg 11933415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 76 - 168
Target Start/End: Original strand, 35237366 - 35237459
Alignment:
76 tgagatgaaggtcgtggtcggcgtgaggaaaaagaggaggccgcaatgtat-aatgtcagatctgaaaggtcagcggtggttgcacttgcacct 168  Q
    |||||||||||||||||||||||||||| ||| ||||||| | | ||| || ||||||||||||||||||   | |||||||||||||||||||    
35237366 tgagatgaaggtcgtggtcggcgtgagggaaaggaggaggtcacgatggatcaatgtcagatctgaaaggatggtggtggttgcacttgcacct 35237459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University