View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0437_low_42 (Length: 232)
Name: NF0437_low_42
Description: NF0437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0437_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 8631396 - 8631504
Alignment:
Q |
1 |
ataaacgcgaattgagaaccgtagggttggtatggaaattcgacgggaagacctccgatgtggtatacatttttagggttaggttttttctcggcggagg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8631396 |
ataaacgcgaattgagaaccgtagggttggtatggaaattcgacgggaagacctccgatgtggtatacatttttagggttaggttttttctcggcggagg |
8631495 |
T |
 |
Q |
101 |
aagaggaat |
109 |
Q |
|
|
||||||||| |
|
|
T |
8631496 |
aagaggaat |
8631504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13 times since January 2019
Visitors: 3251