View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438-Insertion-2 (Length: 209)
Name: NF0438-Insertion-2
Description: NF0438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438-Insertion-2 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 4196382 - 4196181
Alignment:
| Q |
8 |
aaatcttcatgtgtgagcttgaacgtagcacgaagagagtcttcgagctttggttcaaaagctaaaatcttcaagcatctttcgtttcctttttcatttg |
107 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4196382 |
aaatcttcacgtgtgagcttgaacgtagcacgaagagagtcttcgaggtttggttcaaaagctaaaatcttcaagcatctttcgtttcctttttcatttg |
4196283 |
T |
|
| Q |
108 |
ggaacgtgttggttatgagatctctccagttatttgtgaacttataactaagttcatctagatctttcacgatattcctatcaaataatggttgcaattc |
207 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4196282 |
ggaacatgttggttatgaactctctccaattatttgtgaacttatcaccaagttcatctagatctttcacgatattcctatcaaataatggttgtaattc |
4196183 |
T |
|
| Q |
208 |
tc |
209 |
Q |
| |
|
|| |
|
|
| T |
4196182 |
tc |
4196181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 8 - 152
Target Start/End: Complemental strand, 4234125 - 4233981
Alignment:
| Q |
8 |
aaatcttcatgtgtgagcttgaacgtagcacgaagagagtcttcgagctttggttcaaaagctaaaatcttcaagcatctttcgtttcctttttcatttg |
107 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| | |||||||||| ||||||||||||| |||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
4234125 |
aaatcttcacgtgtgagcttgaatgtagaacgaacatagtcttcgagttttggttcaaaaggtaaaatcttcaagcttctttcatttcctttttcatttg |
4234026 |
T |
|
| Q |
108 |
ggaacgtgttggttatgagatctctccagttatttgtgaacttat |
152 |
Q |
| |
|
||||| | ||||||| | || ||||||| ||||||||||||| |
|
|
| T |
4234025 |
ggaacatcatggttattatctccgtccagttttttgtgaacttat |
4233981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 4251141 - 4251038
Alignment:
| Q |
8 |
aaatcttcatgtgtgagcttgaacgtagcacgaagagagtcttcgagctttggttcaaaagctaaaatcttcaagcatctttcgtttcctttttcatttg |
107 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||| |||||||||||| | ||||||||| | |||||||| |||| ||| || |||||||||||| ||| |
|
|
| T |
4251141 |
aaatcttcatgtttgagcttaaaagtagcacgaacagagtcttcgagttgtggttcaaatgggaaaatctttaagcttctatcatttcctttttcacttg |
4251042 |
T |
|
| Q |
108 |
ggaa |
111 |
Q |
| |
|
|||| |
|
|
| T |
4251041 |
ggaa |
4251038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1333 times since January 2019
Visitors: 3228