View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0438-Insertion-4 (Length: 101)

Name: NF0438-Insertion-4
Description: NF0438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0438-Insertion-4
NF0438-Insertion-4
[»] chr2 (2 HSPs)
chr2 (39-101)||(4847497-4847560)
chr2 (8-41)||(4847436-4847469)


Alignment Details
Target: chr2 (Bit Score: 52; Significance: 2e-21; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 39 - 101
Target Start/End: Original strand, 4847497 - 4847560
Alignment:
39 attcttgaaatctcttgttatatggag-acaccttccgaagagcttcaaagactcatttgttta 101  Q
    ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||    
4847497 attcttgaaatctctggttatatggaggacaccttccgaagagcttcaaagactcatttgttta 4847560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 4847436 - 4847469
Alignment:
8 gattggctagcaaattttaacctctcttcagatt 41  Q
    ||||||||||||||||||||||||||||||||||    
4847436 gattggctagcaaattttaacctctcttcagatt 4847469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University