View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0438-Insertion-4 (Length: 101)
Name: NF0438-Insertion-4
Description: NF0438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0438-Insertion-4 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 2e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 39 - 101
Target Start/End: Original strand, 4847497 - 4847560
Alignment:
| Q |
39 |
attcttgaaatctcttgttatatggag-acaccttccgaagagcttcaaagactcatttgttta |
101 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4847497 |
attcttgaaatctctggttatatggaggacaccttccgaagagcttcaaagactcatttgttta |
4847560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 4847436 - 4847469
Alignment:
| Q |
8 |
gattggctagcaaattttaacctctcttcagatt |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4847436 |
gattggctagcaaattttaacctctcttcagatt |
4847469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1352 times since January 2019
Visitors: 3228